Home › Biology, Earth & Space › PCR Primer Tm Calculator

PCR Primer Tm Calculator

Analyses a DNA primer sequence: length, GC content, melting temperature by the Wallace rule 2(A+T) + 4(G+C) and by the basic GC formula 64.9 + 41 × (G+C − 16.4) / N, single-stranded molecular weight, complement, reverse complement, self-complementarity and simple design checks.

When to use

You are designing or checking PCR or sequencing primers and need a quick Tm estimate, GC %, the reverse complement or the oligo's molecular weight.

Do not use when: You need salt- and concentration-corrected nearest-neighbour Tm values (as used by commercial primer tools), degenerate primers beyond N, or modified bases.

Formula

Tm_Wallace = 2 × (A + T) + 4 × (G + C); Tm_basic = 64.9 + 41 × (G + C − 16.4) / N; GC % = 100 × (G + C) / N; MW = 313.21·A + 289.18·C + 329.21·G + 304.2·T − 61.96

Wallace rule (Wallace et al. 1979) and the GC-content formula (Marmur–Doty type) assume about 50 mM Na⁺ and ignore primer concentration and mismatches; they typically differ by several °C from nearest-neighbour values. N counts toward the length only. The molecular weight uses anhydrous nucleotide residue masses with −61.96 for the missing terminal phosphate and added water.

Inputs

ParameterTypeUnitRequiredDescription
sequencestringyes8–60 nucleotides using A, C, G, T (U is treated as T) and N; case-insensitive; spaces, digits and 5'/3' markers are ignored.

Outputs

OutputTypeUnitDescription
lengthintegerntNumber of nucleotides including N.
gc_content_percentnumber%100 × (G + C) / length.
tm_wallacenumber°C2 × (A + T) + 4 × (G + C); intended for primers up to about 13–14 nt but always reported.
tm_basicnumber°C64.9 + 41 × (G + C − 16.4) / N; intended for primers of 14 nt or more.
tm_recommendednumber°CWallace value for sequences up to 13 nt, basic value for 14 nt or more.
molecular_weight_g_molnumberg/molA × 313.21 + C × 289.18 + G × 329.21 + T × 304.2 − 61.96 (linear, 5'-OH, anhydrous); omitted when the sequence contains N.
complementstringBase-by-base complement in the same orientation.
reverse_complementstringComplement read in the opposite direction: the sequence of the opposite strand.
self_complementarybooleantrue when the sequence equals its own reverse complement (palindromic), which favours primer-dimers.
gc_clampbooleantrue when the 3'-terminal base is G or C.
max_homopolymer_runintegerLength of the longest run of identical consecutive bases.
notesstring_listDeviations from common primer guidelines (18–30 nt, GC 40–60 %, Tm 50–65 °C, no runs of 4+, not self-complementary).

Example

20-mer ATGCATGCATGCATGCATGC: {"sequence":"ATGCATGCATGCATGCATGC"} → {"length":20,"gc_content_percent":50,"tm_wallace":60,"tm_basic":51.78,"tm_recommended":51.78,"molecular_weight_g_mol":6117.04,"reverse_complement":"GCATGCATGCATGCATGCAT","complement":"TACGTACGTACGTACGTACG","self_complementary":false,"gc_clamp":true}

12-mer palindrome ACGTACGTACGT: {"sequence":"acgt acgt acgt"} → {"length":12,"gc_content_percent":50,"tm_wallace":36,"tm_basic":29.37,"tm_recommended":36,"molecular_weight_g_mol":3645.44,"reverse_complement":"ACGTACGTACGT","self_complementary":true,"max_homopolymer_run":1}

GET https://tttkmbb.com/api/v1/calculate/pcr-primer-tm?sequence=ATGCATGCATGCATGCATGC

Machine access

Sources

FAQ

Which Tm should I use?

For a first estimate use tm_recommended (Wallace up to 13 nt, basic formula from 14 nt); for annealing temperatures rely on a nearest-neighbour calculation with your actual salt and primer concentrations and start about 3–5 °C below the lower primer Tm.

Why is the Wallace Tm so high for a 20-mer?

The rule adds 2–4 °C per base without bound, so it overestimates Tm for long primers; that is why the GC formula is used from 14 nt.

What does the reverse complement give me?

The sequence of the opposite strand written 5'→3', i.e. what a reverse primer targeting this site must look like.

Related calculators