# PCR Primer Tm Calculator

> Analyses a DNA primer sequence: length, GC content, melting temperature by the Wallace rule 2(A+T) + 4(G+C) and by the basic GC formula 64.9 + 41 × (G+C − 16.4) / N, single-stranded molecular weight, complement, reverse complement, self-complementarity and simple design checks.

- Calculator id: `pcr-primer-tm` · Category: Biology, Earth & Space (`science`) · Tool name: `calculate_pcr_primer_tm`
- Canonical page: https://tttkmbb.com/science/pcr-primer-tm · This document: https://tttkmbb.com/science/pcr-primer-tm.md · JSON definition: https://tttkmbb.com/science/pcr-primer-tm.json

## Purpose

Analyses a DNA primer sequence: length, GC content, melting temperature by the Wallace rule 2(A+T) + 4(G+C) and by the basic GC formula 64.9 + 41 × (G+C − 16.4) / N, single-stranded molecular weight, complement, reverse complement, self-complementarity and simple design checks.

**Use when:** You are designing or checking PCR or sequencing primers and need a quick Tm estimate, GC %, the reverse complement or the oligo's molecular weight.

**Do not use when:** You need salt- and concentration-corrected nearest-neighbour Tm values (as used by commercial primer tools), degenerate primers beyond N, or modified bases.

## Input

| Parameter | Type | Unit | Required | Description |
| --- | --- | --- | --- | --- |
| `sequence` | string |  | required | 8–60 nucleotides using A, C, G, T (U is treated as T) and N; case-insensitive; spaces, digits and 5'/3' markers are ignored. |

## Output

| Field | Type | Unit | Description |
| --- | --- | --- | --- |
| `length` | integer | nt | Number of nucleotides including N. |
| `gc_content_percent` | number | % | 100 × (G + C) / length. |
| `tm_wallace` | number | °C | 2 × (A + T) + 4 × (G + C); intended for primers up to about 13–14 nt but always reported. |
| `tm_basic` | number | °C | 64.9 + 41 × (G + C − 16.4) / N; intended for primers of 14 nt or more. |
| `tm_recommended` | number | °C | Wallace value for sequences up to 13 nt, basic value for 14 nt or more. |
| `molecular_weight_g_mol` | number | g/mol | A × 313.21 + C × 289.18 + G × 329.21 + T × 304.2 − 61.96 (linear, 5'-OH, anhydrous); omitted when the sequence contains N. |
| `complement` | string |  | Base-by-base complement in the same orientation. |
| `reverse_complement` | string |  | Complement read in the opposite direction: the sequence of the opposite strand. |
| `self_complementary` | boolean |  | true when the sequence equals its own reverse complement (palindromic), which favours primer-dimers. |
| `gc_clamp` | boolean |  | true when the 3'-terminal base is G or C. |
| `max_homopolymer_run` | integer |  | Length of the longest run of identical consecutive bases. |
| `notes` | string_list |  | Deviations from common primer guidelines (18–30 nt, GC 40–60 %, Tm 50–65 °C, no runs of 4+, not self-complementary). |

## Formula

`Tm_Wallace = 2 × (A + T) + 4 × (G + C); Tm_basic = 64.9 + 41 × (G + C − 16.4) / N; GC % = 100 × (G + C) / N; MW = 313.21·A + 289.18·C + 329.21·G + 304.2·T − 61.96`

Wallace rule (Wallace et al. 1979) and the GC-content formula (Marmur–Doty type) assume about 50 mM Na⁺ and ignore primer concentration and mismatches; they typically differ by several °C from nearest-neighbour values. N counts toward the length only. The molecular weight uses anhydrous nucleotide residue masses with −61.96 for the missing terminal phosphate and added water.

## Data Sources

- Wallace RB et al. (1979) Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch, Nucleic Acids Res 6(11):3543-3557 — https://pubmed.ncbi.nlm.nih.gov/158748/ (peer_reviewed, retrieved 2026-09-24)
- Wikipedia – Nucleic acid thermodynamics — https://en.wikipedia.org/wiki/Nucleic_acid_thermodynamics (reference, retrieved 2026-09-24)
- Wikipedia – Primer (molecular biology) — https://en.wikipedia.org/wiki/Primer_(molecular_biology) (reference, retrieved 2026-09-24)

Data freshness: `static`. Deterministic formula with fixed constants; results never go stale. Inputs supplied by the caller determine the output.

## API

- `GET https://tttkmbb.com/api/v1/calculate/pcr-primer-tm?sequence=…`
- `POST https://tttkmbb.com/api/v1/calculate/pcr-primer-tm` with JSON body `{"inputs": {…}}`
- Response: unified envelope (`success`, `request`, `result.values`, `result.units`, `sources`, `freshness`, `timestamp`, `next_actions`, `links`); see https://tttkmbb.com/docs/response-format.md
- Schema: https://tttkmbb.com/api/v1/calculators/pcr-primer-tm · OpenAPI operationId `calculate_pcr_primer_tm` in https://tttkmbb.com/openapi.json
- Authentication: none. Rate limit: fair use, see https://tttkmbb.com/docs/rate-limits.md.

## MCP

- Server: `https://tttkmbb.com/mcp` (Streamable HTTP, JSON-RPC 2.0, no auth)
- Tool:  `run_calculator` with `{"calculator_id": "pcr-primer-tm", "inputs": {…}}`

## Example

- 20-mer ATGCATGCATGCATGCATGC: inputs `{"sequence":"ATGCATGCATGCATGCATGC"}` → `{"length":20,"gc_content_percent":50,"tm_wallace":60,"tm_basic":51.78,"tm_recommended":51.78,"molecular_weight_g_mol":6117.04,"reverse_complement":"GCATGCATGCATGCATGCAT","complement":"TACGTACGTACGTACGTACG","self_complementary":false,"gc_clamp":true}`
- 12-mer palindrome ACGTACGTACGT: inputs `{"sequence":"acgt acgt acgt"}` → `{"length":12,"gc_content_percent":50,"tm_wallace":36,"tm_basic":29.37,"tm_recommended":36,"molecular_weight_g_mol":3645.44,"reverse_complement":"ACGTACGTACGT","self_complementary":true,"max_homopolymer_run":1}`

```
GET https://tttkmbb.com/api/v1/calculate/pcr-primer-tm?sequence=ATGCATGCATGCATGCATGC
```

## Limitations

You need salt- and concentration-corrected nearest-neighbour Tm values (as used by commercial primer tools), degenerate primers beyond N, or modified bases. Wallace rule (Wallace et al. 1979) and the GC-content formula (Marmur–Doty type) assume about 50 mM Na⁺ and ignore primer concentration and mismatches; they typically differ by several °C from nearest-neighbour values. N counts toward the length only. The molecular weight uses anhydrous nucleotide residue masses with −61.96 for the missing terminal phosphate and added water. All values are computed from the formula above; no measurement or live data is involved.

## FAQ

**Which Tm should I use?**

For a first estimate use tm_recommended (Wallace up to 13 nt, basic formula from 14 nt); for annealing temperatures rely on a nearest-neighbour calculation with your actual salt and primer concentrations and start about 3–5 °C below the lower primer Tm.

**Why is the Wallace Tm so high for a 20-mer?**

The rule adds 2–4 °C per base without bound, so it overestimates Tm for long primers; that is why the GC formula is used from 14 nt.

**What does the reverse complement give me?**

The sequence of the opposite strand written 5'→3', i.e. what a reverse primer targeting this site must look like.

## Related

- [DNA / RNA Concentration Calculator](https://tttkmbb.com/science/dna-concentration.md) — Quantify the primer or template from an A260 reading.
- [Molar Mass Calculator](https://tttkmbb.com/chemistry/molar-mass.md) — Molar mass of other molecules from a chemical formula.
- [Molarity Calculator](https://tttkmbb.com/chemistry/molarity.md) — Prepare a primer stock of known molarity from its mass and molecular weight.